Why gains slow!

Probably. The question is whether these same inhibitors will also inhibit gains, which, after all, require the production of new tissue. The goal is to promote growth, but without strengthening the tissues to the point that they resist further extension.

I agree with you that, as long as they are safe (and that’s perhaps the tricky part), compounds that inhibit or delay healing are prime candidates for extending newbie gains.

If you haven’t seen it already, be sure to check out the paper on PD posted above (Graziottin_326_340.pdf). Toward the end there is a table of compounds that are thought to help break up fibrosis. Many of these were mentioned earlier in this thread by you, Shiver, and Mr. Tips. Regardless of whether “fibrosis” and “strengthening” are really the same, it’s certainly worth considering whether each of these compounds can offer benefits to PE’ers.

Does anyone have objections at this point?

If not, I agree with ModestoMan on the next steps:

How do we inhibit in a smart way so that we gain?

What are the safe and easy to get compounds we should consider?

I agree 100%. I would add only that one must also time one’s exercises to stress the tissues before they strengthen to the point that they become resistant to further extension.

This sounds fine, provided one is not healing so fast that the tissues become resistant to exercise.

From post 100:

June 1997, Volume 12, Number 6
Page 929

Peyronie’s Disease Is Associated with Paget’s Disease of Bone*

KENNETH W. LYLES,1,2,3 DEBORAH T. GOLD,2,4 REBECCA A. NEWTON,2,3 SOHAIL PAREKH,1,2,3 KATHY M. SHIPP,2,5 CARL F. PIEPER,2,6 RAMESH KRISHAN,7 and CULLEY C. CARSON, III7

From post 107:

Platelet-derived growth factor (PDGF) and PDGF receptors in
rat corpus cavernosum: changes in expression after transient
in vivo hypoxia
A Aversa1,2, S Basciani3, P Visca4, M Arizzi3, L Gnessi3,
G Frajese2 and A Fabbri2
1AFaR-CRCCS, Ospedale Fatebenefratelli-Isola Tiberina, 00186 Rome, Italy
2Cattedra di Endocrinologia, Università degli Studi ‘Tor Vergata’, Ospedale Fatebenefratelli-Isola Tiberina, 00186 Rome, Italy
3Dipartimento Fisiopatologia Medica, Università degli Studi ‘La Sapienza’ 00161 Rome, Italy
4Servizio di Anatomia Patologica-IFO, Polo Oncologico ‘Istituto Regina Elena’, 00100 Rome, Italy
(Requests for offprints should be addressed to A Aversa, Cattedra di Endocrinologia, Università di Roma ‘Tor Vergata’, Via di Torvergata 135,
00133 Roma, Italy; Email: amfaversa@yahoo.com)
Abstract
Platelet-derived growth factor (PDGF) overactivity has
been implicated in atherosclerosis and several fibrotic
conditions including lung and kidney fibrosis, liver
cirrhosis and myelofibrosis. Low oxygen tension (hypoxia)
is a known stimulus for transcriptional induction of PDGF
ligand and receptor genes in different tissues. We studied
the expression and localization of PDGF-A, PDGF-B, and
PDGF receptor (PDGFR)-
and - subunits in adult
rat isolated corpus cavernosum (CC) under generalized
transient hypoxia (pO2 10%) in comparison with
normoxic conditions. Semi-quantitative RT-PCR analysis
of mRNA extracted from rat penis showed higher
amounts of PDGF-A, PDGF-B and PDGFR- mRNA
transcripts in hypoxic versus normoxic animals. The
immunohistochemical analysis showed that the localization
of PDGF subunits and PDGFR- was confined to the
cytoplasm of the perivascular smooth muscle cells, endothelium
and trabecular fibroblasts. Our findings indicate
that transient low oxygen tension induces PDGF overexpression
in rat CC, which in the long term may lead to
an increase of connective tissue production. We suggest
that a local impairment of the PDGF/PDGFR system may
contribute to CC fibrosis, which is an established cause of
erectile dysfunction in man.
Journal of Endocrinology (2001) 170, 395–402
Introduction
Platelet-derived growth factor (PDGF) is a major mitogen
for cells of mesenchymal origin, such as fibroblasts and
smooth muscle cells. PDGF is widely expressed in normal
and transformed cells and is produced by monocytes and
macrophages, vascular endothelial and smooth muscle cells
(Antoniades 1991, Heldin 1992). There are three PDGF
isoforms (AA, AB and BB) that exert their biological
actions via binding to cell surface receptors (
and ) that
belong to the protein tyrosine-kinase family of receptors
(Williams 1989). PDGF-mediated events, which include
chemoattraction, activation of inflammatory cells, vasoconstriction
and influence on the synthesis or degradation
of matrix constituents (Heldin 1992), are most likely
exerted locally in an autocrine or paracrine manner and are
involved in natural as well as pathological processes, such as
neoplasia, atherosclerosis and fibrosis (Heldin 1992, Gnessi
et al. 1993). Recently, immunohistochemical and electron
microscopy studies showed that PDGF is highly expressed
in penile tunica albuginea obtained from patients with
veno-occlusive dysfunction and Peyronie’s disease
(Gentile et al. 1996), suggesting that it could be involved
in the pathogenesis of these two conditions that are
frequently associated with erectile dysfunction (ED) in
men.
In vivo, the reduction in the environmental oxygen
tension to which cells are exposed leads to physiological
and, eventually, pathological consequences associated with
differential expression of specific genes which encode for
cytokines and growth factors thought to play key roles in
the regulation of synthesis and assembly of connective
tissue proteins (Gerritsen & Bloor 1993, Bunn & Poyton
1996). For example, in rat corpus cavernosum smooth
muscle cells in culture hypoxia stimulates the expression of
transforming growth factor 1 (TGF-1), a pleotrophic
cytokine that is known to induce extracellular matrix
expression and inhibit growth and proliferation of vascular
smooth muscle cells (Faller 1999). Indeed, in human
corpus cavernosum smooth muscle cells, TGF-1 is a
395
Journal of Endocrinology (2001) 170, 395–402
0022–0795/01/0170–395
2001 Society for Endocrinology Printed in Great Britain
Online version via Society for Endocrinology | A world-leading authority on hormones
mitogen and induces a two- to fourfold increase in
collagen synthesis (Moreland et al. 1995); also, it has been
found to be overexpressed in tunica albuginea from men
suffering venocclusive dysfunction (Nehra et al. 1996) and
in plaques obtained from Peyronie’s disease (El-Sakka et al.
1997).
In this study, we compared for the first time the
expression of PDGF subunits and PDGF receptor mRNAs
in corpora cavernosa (CC) isolated from adult rats both
in normal conditions and after acute hypoxia (pO2=
10 mmHg). The immunohistochemical localization of
PDGF-A, PDGF-B and PDGF receptor (PDGFR)-
and
- subunits was also evaluated in comparison with that of
the TGF-1.
Materials and Methods
Hypoxic exposure and CC preparation
Male Sprague–Dawley rats (55–60 days) purchased from
Charles River Italia (Calco, Italy), were continuously
gassed for 6 h with a mixture of 10% O2 and 90% N2 (ten
rats) or normal air (ten rats) in a 7060100 cm
gas-tight box (Bucher et al. 1996); animals were conscious
and had free access to food and water. At the end of the
procedure decapitation was performed, blood was collected
from the left ventricle for pO2, sO2 and pCO2
determination by hemogasanalysis (Franchini et al. 1994),
and CC were rapidly prepared according to Broderick
et al. (1994) with minor modifications. Briefly, rat penises
were surgically removed and the corpus spongiosum and
the urethra were excised. The CC tissues were carefully
dissected free from the surrounding tunica albuginea and
made available for RT-PCR and immunohistochemical
studies. The Animal Care Committee of the University of
Rome Medical School approved this protocol.
RNA extraction and RT-PCR analysis
Tissues mRNA were extracted by using a commercial kit
(Micro-Fast-Track Kit, Invitrogen, San Diego, CA,
USA). Reverse transcription was performed using an
annealing temperature of 70 C in a final volume of 25 µl
containing 250 mM Tris–HCl, 375 mM KCl, 15 mM
MgCl2, 50 mM dithiothreitol (DTT), 0·5 mM dNTPs,
0·5 µg random hexamer oligonucleotide, 200 U M-MLVRT,
26 U ribonuclease inhibitor (Promega, Madison, WI,
USA). -actin was used as a constutively expressed gene
product for comparison of PDGFs and PDGFRs mRNA
abundance between samples. A 0·5 µl volume of the RT
products was amplified with 2·5 units of Taq DNA
polymerase (Promega) and 20 µM specific rat -actin
primer (Table 1) in 50 µl of reaction mix containing
500 mM KCl, 200 mM Tris–HCl, and 1·5 mM MgCl2 as
follows: 94 C, 1 min; 58 C, 1 min; 72 C, 1 min. To
ensure amplification in the exponential phase of PCR,
reactions were temporarily halted at 20, 25, 30, 35 and
40 cycles, and 10 µl of PCR products were removed from
each tube (see Fig. 1). All products were analyzed by 1·5%
agarose gel electrophoresis and 30 cycles were chosen for
further analysis. Quantitation of the signals was performed
by densitometric analysis, using densitometry computer
software (Kodak Digital Science ID Image Analysis
Software, Eastman Kodak Company, Rochester, NY,
USA). Dilution of RT products was made where necessary
and the amplification procedure was repeated until all
samples were standardized for -actin content. After
standardization, PCR was performed using appropriately
diluted RT products in 50 µl of the reaction mix by
utilizing 20 µM of each rat PDGFs and PDGFRs primers
(Table 1). For each gene examined, all primers were
derived from separate exons and spanned at least one
intron of genomic sequence, thus excluding the possibility
of genomic DNA contamination. No PCR product was
obtained with any of the set of primers in the absence of
cDNA template (negative control) (Caprio et al. 1999).
Thermocycling conditions were: initial denaturation for
3 min at 94 C, 30 cycles of amplification (since levels of
PCR products increased in a linear fashion for up to
35 cycles for PDGFs and PDGFRs, Fig. 1) with 1 min of
denaturation at 94 C, different annealing temperature for
each pair of primers (Table 1), 1 min extension at 72 C,
followed by a final elongation of 5 min at 72 C.
Immunohistochemistry and light microscopy
After decapitation, the skin overlying the penis was
incised, and the whole penis body, including the CC crura
and the bulbospongiosum covered by the ischiocavernous
and bulbospongiosus skeletal muscles, was excised in
one piece, fixed in Bouin’s solution for 12 h, and prepared
for immunostaining (Gnessi et al. 1993, 2000). Immunostaining
was carried out by incubating tissue sections
(3 µm) with TGF-1, PDGFs and PDGFRs antisera
(1:100) overnight at 4 C (Gnessi et al. 1993, Caprio
Table 1 Primers utilized in PCR reactions
5–3 sequence Position
Substance
PDGF-A1 CCTGTGCCATCCGCAGGAAGAGA 215–239
PDGF-A2 TTGGCCACCTTGACGCTGCGGTG 418–441
PDGF-B1 GATCCGCTCCTTTGATGATC 1203–1223
PDGF-B2 GTCTCACACTTGCATGCCAG 1617–1637
PDGF-
1 CGACTCCAGATGGGAGTTCCC 1881–1902
PDGF-
2 TGACATCCACTTCACAGGCA 2704–2724
PDGF-1 CACCATTTCGAGCACCTTTGT 28–49
PDGF-2 AGGGCACTCCGAAGAGGTAA 684–704
-actin 1 ATTGGCAATGAGCGGTTCCGC 2413–2437
-actin 2 CTCCTGCTTGCTGATCCACATC 2727–2349
A AVERSA and others · Rat penile PDGF and hypoxia 396
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
et al. 1999). The following antisera were used: rabbit
anti-human TGF-1 (Research Diagnostics, Inc.,
Flanders, NJ, USA), affinity purified polyclonal rabbit
anti-PDGF-BB and anti-PDGF-AA antibodies
(Genzyme, Cambridge, MA, USA); PDGFR-7 and
PDGFR-3, rabbit polyclonal antisera to the PDGFR-

and  subunit respectively (provided by Dr Carl-Henrik
Heldin, Ludwig Institute for Cancer Research, Uppsala,
Sweden). PDGFR-7 was generated against a synthetic
peptide covering amino acids 1066–1084 of the COOHterminal
region of human PDGFR-
subunit and does not
cross-react with the PDGFR- subunit. It recognizes both
human and rat PDGFR-
subunit. PDGFR-3 was raised
against a synthetic peptide corresponding to amino acids
981–994 of the mouse PDGFR-. It recognizes rat
PDGFR- subunit. PDGFR-7 and PDGFR-3 were
affinity purified on columns with immobilized synthetic
peptides against which the antisera were raised
(Hermanson et al. 1992, Gnessi et al. 1995). All the
antibodies react specifically with the respective antigens in
immunoprecipitation and Western blotting experiments
(Hermanson et al. 1992, Eccleston et al. 1993). For better
identification of smooth muscle cells lining the cavernosal
spaces, adjacent sections were immunostained with a
primary antismooth muscle
-actin antibody diluted up to
2 µg/ml at room temperature (DAKO Corp., Trappes,
France). At the end of incubation immunopositivity was
visualized by the streptavidin–biotin immunoperoxidase
technique, using a commercial kit (Zymed Lab. Inc., San
Francisco, CA, USA). Slides were developed using
amino-ethylcarbazole (AEC) as chromogenic substrate
that is converted by the peroxidase into a red to brownishred
precipitate at the sites of antigen localization in the
tissue. The preparations were counterstained with hematoxylin,
dehydrated, cleared and mounted (Claesson-
Welsh et al. 1989). The immunohistochemical expression
of TGF-1 was used as a positive control of tissue hypoxia.
Results were evaluated by using a semi-quantitative
staining intensity of immunoreactive TGF-1, PDGF
peptides and receptors on three consecutive sections of rat
CC for each antisera were examined. We evaluated
positive endothelial, perivascular smooth muscle and
trabecular fibroblast cells counted on five microscopic
cellular areas (40) for all sections of hypoxic and
normoxic rat CC. The positive staining intensity was
scored on a four-tiered scale: negative=0; low intensity=
1; moderate intensity=2; and strong intensity=3.
The staining distribution and intensity were determined
by two observers independently (P V and M A) with
subsequent reconciliation of scored values.
-actin immunostaining
was considered as positive or negative
(Gnessi et al. 1995, Visca et al. 1999). Thereafter, we
calculated the overall means (n=15, resulting from evaluation
of 5 microscopic cellular areas for three sections) of
staining intensity for each cellular subtype of each hypoxic
and normoxic CC examined. The total means of 150
scores (15 scores for ten hypoxic and normoxic rat CC
respectively) of the staining intensity for each cellular
components of hypoxic tissues were then compared with
the total means of the 150 scores obtained from normoxic
tissues. A score of zero was considered to be negative (–);
mean scores between 0 and 1 were considered as weak
staining intensity (+/–); mean scores between 1·1 and 2
Figure 1 Optimization of RT-PCR conditions for semi-quantitative
determination of hypoxic PDGFs and PDGFRs and -actin mRNA.
For amplification in the exponential phase of PCR, different
numbers of cycles were tested for each message. Quantitative
analysis of cycle-dependency for the generated PCR signals
revealed a strong linear relationship between cycles 20 and 35 for
PDGF-A (correlation coefficient r2=0·9889) and between cycles
20 and 40 for other targets (r2=0·9778 for PDGFR-
, r2=0·9840
for PDGF-B, r2=0·9921 for PDGFR-, and r2=0·9442 for -actin).
Values are given as meansS.D. of three independent
determinations. A representative ethidium bromide-stained gel
electrophoresis of the DNA products generated for each target is
presented in the insets. OD, optical density.
Rat penile PDGF and hypoxia · A AVERSA and others 397
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
were considered as moderate staining intensity (+); and
mean scores between 2·1 and 3 were considered as strong
staining intensity (++) (see Table 2).
Statistical analysis
Student’s t-test for unpaired data was used for statistical
analysis of the results. Data are presented as means..
unless otherwise specified; P values less than 0·05 were
considered to be statistically significant.
Results
Effects of generalized hypoxia on blood gas parameters
After euthanization, hypoxic rats had higher pCO2 and
lower arterial pO2 than control animals (80·13·2 vs
50·72·1 mmHg, P<0·001, and 20·25·1 vs 48·34·0
mmHg, P<0·001 respectively) as well as lower sO2
(17%7% vs 70%5%, P<0·001).
PDGF and PDGFRs mRNA expression in isolated rat CC
Figure 1 shows the linearity of PCR response for each
individual primer in hypoxic tissues. The linearity of PCR
response in normoxic tissues was similar (data not shown).
Semi-quantitative RT-PCR analysis of mRNA extracted
from CC of the rat penis showed higher amounts of
PDGF-A, PDGF-B and PDGFR- mRNA transcripts in
hypoxic versus control rats (P<0·001); no differences were
found in PDGFR-
mRNA expression (Fig. 2, upper and
lower panel). Hypoxia did not modify -actin content.
Immunohistochemical localization of TGF-
1, PDGF and
PDGFRs in rat CC
Immunohistochemical localization of PDGF-A, PDGF-B,
PDGFR-
, PDGFR- and TGF-1 in CC both after
acute hypoxia and in normal conditions is shown in Fig. 3.
In normoxic rats staining for PDGF peptides and receptors
and TGF-1 occurred in endothelial cells, perivascular
smooth muscle cells and in the fibroblasts of the connective
trabecular structures of the CC (Fig. 3B,D,F,H,J). For all
peptides, cytoplasmic localization was focal in the endothelium,
diffuse in the perivascular smooth muscle cells
and perinuclear in the fibroblasts of the trabeculae of
overall CC examined. The immunohistochemical localization
in hypoxic animals was similar (Fig. 3A,C,E,G,J).
The semi-quantitative comparison of staining intensities
showed that in the endothelial cells PDGF peptides,
PDGFR- and TGF-1 immunoreactivity was more
intense in hypoxic versus normoxic rat CC (Table 2).
Perivascular smooth muscle cells, which also stained for

-actin (data not shown), showed a stronger signal in
hypoxic versus normoxic rat for PDGF-A, PDGF-B and
PDGFR-; on the contrary, PDGFR-
staining intensity
was not modified. The staining pattern in fibroblasts of the
connective trabecular structures was similar to that
described for the endothelium (Table 2). In hypoxic rat
CC the TGF-1 immunostaining was more intense in all
structures when compared with normoxic rats (Table 2
and Fig. 3I,J).
Discussion
The trabecular smooth muscle cells of the CC regulate
penile vasoconstriction and vasodilation, and consist
primarily of smooth muscle and extracellular connective
tissue matrix delimitating vascular lacunae lined by the
endothelium. The volumetric contribution of the corporal
endothelium and autonomic nerves is considered to be
negligible. The percent trabecular smooth muscle content
in normal patients has been reported to range from 42 to
50% (Moreland et al. 1995). In vasculogenically impotent
patients a decrease in the percentage of trabecular smooth
muscle content has been described, with levels ranging
Table 2 Comparative semi-quantitative staining intensity of immunoreactive TGF-1, PDGF peptides and receptors within the hypoxic and
normoxic rat corpus cavernosum. Values in parentheses are meansS.E.
PDGF-A PDGF-B PDGFR-
PDGFR- TGF-1
H N H N H N H N H N
Corpus
cavernosum
Endothelium ++
(2·60·1)
+
(1·20·05*)
++
(2·60·1)
+
(1·20·1*)
+
(1·70·1)
+
(1·50·1)
++
(2·20·1)
+
(1·20·05*)
++
(2·80·1)
+
(1·60·09*)
Perivascular
SMCs
++
(2·70·2)
+
(1·20·05*)
++
(2·80·1)

(0·00·0*)
+
(1·60·1)
+
(1·70·1)
++
(2·50·1)
+
(1·20·1*)
++
(2·70·2*)
+/
(0·90·05*)
Fibroblasts of
the trabeculae
++
(2·80·1)
+
(1·30·1*)
+
(1·90·05)
+/
(0·50·08*)
+
(1·30·1)
+
(1·20·1)
++
(2·80·1)
+
(1·30·1*)
++
(2·80·07)
+
(1·40·08*)
 negative; +/ weak; + moderate; ++ strong staining intensity (*P<0·01).
H=hypoxic rats; N=normoxic rats; SMCs=smooth muscle cells.
A AVERSA and others · Rat penile PDGF and hypoxia 398
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
from 28 to 35% out of normal content; also, it has been
shown that in CC the relative amount of trabecular
smooth muscle content is regulated by oxygen tension via
activation of nitric oxide pathway (Kim et al. 1993,
Kourembanas et al. 1997).
Here we evaluated for the first time the PDGF peptides
and PDGF receptor expression in the rat CC after
transient in vivo hypoxia in order to determine whether
changes in oxygen tension may alter their expression
inside the penis and be involved in the pathogenesis of
CC fibrosis. Previous studies have shown that hypoxia
stimulates PDGF expression in the rat lungs and may be
involved in the pathogenesis of idiopathic pulmonary
fibrosis (Katayose et al. 1993, Betsholtz & Raines 1997).
Moreover, incubation under hypoxic conditions stimulates
the release of PDGF from human macrophages and
cultured endothelial cells (Kuwabara et al. 1995, Betsholtz
& Raines 1997), as well as strongly up-regulates the
PDGF-B chain gene expression (Kourembanas et al.
1990). In normal penile human tissues, vasal endothelial
cells constitutively express PDGF; furthermore, fibroblasts
from pathological tunica albuginea of impotent men with
Peyronie’s disease and venocclusive dysfunction show
intense immunostaining for PDGF-A and -B chains
(Gentile et al. 1996). As a consequence, a higher expression
of PDGF-A and -B proteins may determine an
imbalance between trabecular smooth muscle and connective
tissue ratio resulting in CC fibrosis and erectile
dysfunction. In our study, we found that PDGF and
PDGFR are constitutively expressed in the rat vascular
endothelial cells as well as in penile nerves. More important,
in the corpora of hypoxic rats there was a higher
expression of PDGF-A and -B proteins than in normoxic
rats. Immunohistochemistry showed that the expression
was focal in the endothelium, diffuse in the perivascular
smooth muscle cells and perinuclear in the fibroblasts of
the trabeculae. After exposure to transient low oxygen
tension, PDGFR- expression was also increased in the
same cell components of CC expressing PDGF peptides,
suggesting that in this condition these cells become a more
sensitive target for PDGF peptides. The absence of modi-
fications in PDGFR-
expression may be explained with
the concomitant overexpression of TGF-1 which is
known to down-regulate PDGFR-
in human fibroblasts
(Bonner et al. 1995, Kuwabara et al. 1995). Thus, the
PDGF overexpression in penile structures under transient
hypoxia may well contribute to the cascade of events
leading to tissue fibrosis under chronic hypoxic conditions.
These events may occur in some patients with erectile
dysfunction in which a chronic CC hypoxia has been
reported (Tarhan et al. 1997).
In the rat, it has been demonstrated that growth factors
may be involved in the autocrine/paracrine loop involved
in tissue fibrosis (Battegay et al. 1990). TGF-1 is overexpressed
in tissues chronically exposed to experimental
hypoxia and has a key role in determining lung and kidney
fibrosis (Border & Noble 1994). In cultured human CC
smooth muscle cells, TGF-1 stimulates the synthesis of
fibrillar collagen (Moreland 1998) and it has been involved
in the increased collagen trabecular smooth muscle cell
synthesis that occurs under hypoxic conditions (Moreland
et al. 1995). Furthermore, intrapenile oxygen tensions
consistent with flaccid blood pO2 (30 mmHg) increase
TGF-1 mRNA expression by approximately twofold in
18 h and threefold in 24 h in men (Moreland 1998).
Accordingly, we found that exposure of penile tissue to
transient low blood pO2 (
20 mmHg) in vivo led to an
Figure 2 Upper panel, RT-PCR expression analysis of PDGF
peptides and PDGF receptors in corpus cavernosum of hypoxic
and normoxic rats, in rat testis (positive control) and in the
absence of cDNA template (negative control). All data were
normalized for -actin (internal control) and quantified by
densitometry computer software. Lower panel, mean
densitometric analysis of the results obtained from three
consecutive experiments; the S.E. was less than 10% (*P<0·001).
Solid bars indicate hypoxic and open bars indicate normoxic rats.
OD, optical density.
Rat penile PDGF and hypoxia · A AVERSA and others 399
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
Figure 3 Immunohistochemical staining pattern of PDGF-A (A, B), -B (C, D) and PDGFR-
(E, F) and - (G, H) with affinity-purified
antibody in cross-sections of hypoxic (A, C, E, G) by comparison with normoxic (B, D, F, H) rat corpus cavernosum, counterstained with
hematoxylin. The expression was intense in the cytoplasm of trabecular fibroblasts (triangles) and endothelial cells (arrowheads), and more
diffuse in smooth muscle cells (arrows). The scale bar in A represents 25 m and applies to A-H. Sections of rat corpus cavernosum
immunostained for TGF-1 in hypoxic (I) and normoxic (J) conditions are also shown. The scale bar in I represents 50 m and also applies
to J. TF=fibroblasts of the trabeculae; E=endothelium; V=vessel; SM=smooth muscle cells.
A AVERSA and others · Rat penile PDGF and hypoxia 400
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
increased TGF-1 immunostaining in the rat penile CC,
suggesting that multiple genes encoding matrix molecules
leading to fibrotic alterations inside the penis may be
activated even during transient hypoxia, similar to that
described in the endothelium (Gerritsen & Bloor 1993).
Low-low priapism is a frequent complication of vasoactive
intracavernous pharmacotherapy in men affected by
erectile dysfunction, especially when combination drugs
are used (Fabbri et al. 1997). Human CC undergo major
ultrastructural changes, i.e. corporeal fibrosis during
priapism, but pharmacological detumescence is not
recommended until 12 h has passed (Hauri et al. 1983).
However, it is known that in a rabbit model, hypoxia
induced by prolonged erection and subsequent local
acidosis impair contractility of trabecular smooth muscles.
This phenomenon impedes the drainage of blood, perpetuates
the ischemic state and may cause early ultrastructural
changes (Kim et al. 1996, Saenz de Tejada et al. 1997,
Moon et al. 1999). Taking into account our findings,
the risk that fibrotic alterations may begin early after
acute hypoxia has occurred inside the corpora is quite
elevated. Thus, in the clinical outpatient setting prompt
detumescence of erections that exceed a duration of 2 h
should be recommended (Aversa et al. 2000).
In conclusion, transient in vivo hypoxia increases the
expression of the PDGF system in the rat penis. It is
conceivable that these changes may occur also in conditions
of chronic hypoxia in men and may lead to
alterations in penile structures similar to those already
described in other organs (Wespes et al. 1998, Okabe et al.
1999). These phenomena might contribute to the pathogenesis
of erectile dysfunction that frequently complicate
atherosclerosis, diabetes mellitus, hypertension, obstructive
pulmonary disease and intense cigarette smoking.
Acknowledgements
We thank Dr Massimiliano Caprio for the critical reading
of the manuscript. Presented at the 81st International
Congress of the Endocrine Society, 12–15 June, San
Diego, CA, 300, 1999, P2–91.
References
Antoniades HN 1991 PDGF: a multifunctional growth factor. Baillieres
Clinical Endocrinology and Metabolism 5 595–613.
Aversa A, Bonifacio V, Moretti C, Frajese G & Fabbri A 2000
Re-dosing of prostaglandin-E1 versus prostaglandin-E1 plus
phentolamine in male erectile dysfunction: a dynamic color power
Doppler study. International Journal of Impotence Research 12 33–40.
Battegay EJ, Raines EW, Seifert RA, Bowen-Pope DF & Ross R
1990 TGF-beta induces bimodal proliferation of connective tissue
cells via complex control of an autocrine PDGF loop. Cell 63
515–524.
Betsholtz C & Raines EW1997 Platelet-derived growth factor: a key
regulator of connective tissue cells in embryogenesis and
pathogenesis. Kidney International 51 1361–1369.
Bonner JC, Badgett A, Lindroos PM & Osornio-Vargas AR 1995
Transforming growth factor beta 1 downregulates the plateletderived
growth factor-alpha-receptor subtype on human lung
fibroblasts in vitro. American Journal of Respiratory Cell and Molecular
Biology 13 496–505.
Border WA & Noble NA 1994 Mechanisms of disease: transforming
growth factor- in tissue fibrosis. New England Journal of Medicine
331 1286–1292.
Broderick GA, Gordon D, Hypolite J & Levin RM 1994 Anoxia and
corporeal smooth muscle dysfunction: a model for ischemic
priapism. Journal of Urology 151 259–262.
Bucher M, Sandner P, Wolf K & Kurtz A 1996 Cobalt but not
hypoxia stimulates PDGF gene expression in rats. American Journal of
Physiology. Endocrinology and Metabolism 271 E451–E457.
Bunn HF & Poyton RO 1996 Oxygen sensing and molecular
adaptation to hypoxia. Physiological Reviews 76 839–885.
Caprio M, Isidori AM, Carta AR, Moretti C, Dufau ML & Fabbri A
1999 Expression of functional leptin receptors in rodent Leydig
cells. Endocrinology 140 4939–4947.
Claesson-Welsh L, Hammacher A, Westermark B, Heldin CH &
Nister M 1989 Identification and structural analysis of the type A
receptor for platelet-derived growth factor: similarity with the type
B receptor. Journal of Biological Chemistry 264 1742–1747.
Eccleston PA, Funa K & Heldin CH 1993 Expression of
platelet-derived growth factor (PDGF) and PDGF
- and
-receptors in the peripheral nervous system: an analysis of
sciatic nerve and dorsal root ganglia. Developmental Biology 155
459–470.
El-Sakka AI, Hassoba HM, Pillarisetty RJ, Dahiya R & Lue TF 1997
Peyronie’s disease is associated with an increase in transforming
growth factor- protein expression. Journal of Urology 158
1391–1394.
Fabbri A, Aversa A & Isidori A 1997 Erectile dysfunction: an
overview. Human Reproduction Update 3 455–466.
Faller DV 1999 Endothelial cell responses to hypoxic stress. Clinical
and Experimental Pharmacology and Physiology 26 74–84.
Franchini KG, Cestari IA & Krieger EM 1994 Restoration of arterial
blood oxygen tension increases arterial pressure in sinoaotricdenervated
rats. American Journal of Physiology 226 H1055–H1061.
Gentile V, Modesti A, La Pera G, Vasaturo F, Modica A, Prigiotti G,
Di Silverio F & Scarpa S 1996 Ultrastructural and
immunohistochemical characterization of the tunica albuginea in
Peyronie’s disease and veno-occlusive dysfunction. Journal of
Andrology 17 96–103.
Gerritsen ME & Bloor CM 1993 Endothelial cell gene expression in
response to injury. FASEB Journal 7 523–532.
Gnessi L, Emidi A, Scarpa S, Palleschi S, Ragano-Caracciolo M,
Silvestroni L, Modesti A & Spera G 1993 Platelet-derived growth
factor effects on purified testicular peritubular myoid cells: binding,
cytosolic Ca2+ increase, mitogenic activity and extracellular matrix
production enhancement. Endocrinology 133 1880–1890.
Gnessi L, Emidi A, Jannini EA, Carosa E, Maroder M, Arizzi M,
Ulisse S & Spera G 1995 Testicular development involves the
spatiotemporal control of PDGFs and PDGF receptors gene
expression and action. Journal of Cellular Biology 4 1105–1121.
Gnessi L, Basciani S, Mariani S, Arizzi M, Spera G, Wang C,
Bondjers C, Karlsson L & Betsoltz C 2000 Leydig cell loss and
spermatogenic arrest in platelet-derived growth factor (PDGF)-
A-deficient mice. Journal of Cellular Biology 149 1019–
1025.
Hauri D, Spycher M & Bruhlmann W 1983 Erection and priapism: a
new physiopathological concept. Urology International 38 138–145.
Heldin CH 1992 Structural and functional studies on platelet-derived
growth factor. EMBO Journal 11 4251–4259.
Hermanson M, Funa K, Hartman M, Claesson-Welsh L, Heldin CH,
Westermark B & Nister M 1992 Platelet-derived growth factor and
Rat penile PDGF and hypoxia · A AVERSA and others 401
Society for Endocrinology | A world-leading authority on hormones Journal of Endocrinology (2001) 170, 395–402
its

From post 49:
Male Reproductive Tract

Sonic hedgehog Cascade Is Required for Penile Postnatal Morphogenesis, Differentiation, and Adult Homeostasis1
Carol A. Podlasek2,a, David J. Zelnera, Hong Bin Jianga, Yi Tanga, John Houstona, Kevin E. McKennaa and Kevin T. McVarya

a Department of Urology and Physiology, Northwestern University Medical School, Chicago, Illinois 60611

ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


The penis is unique in that it undergoes morphogenesis and differentiation primarily in the postnatal period. For complex structures such as the penis to be made from undifferentiated precursor cells, proliferation, differentiation, and patterning are required. This process involves coordinated activity of multiple signals. Sonic hedgehog (Shh) forms part of a regulatory cascade that is essential for growth and morphogenesis of many tissues. It is hypothesized that the penis utilizes regulatory mechanisms similar to those of the limb and accessory sex organs to pattern penile postnatal morphogenesis and differentiation and that the Shh cascade is critical to this process. To test this hypothesis, Shh, BMP-4, Ptc, and Hoxa-10 localization and function were examined in Sprague-Dawley rat penes by means of quantitative reverse transcription polymerase chain reaction, in situ hybridization, immunohistochemistry, and Western blotting. These genes were expressed in the penis during postnatal morphogenesis in a spatially and temporally restricted manner in adjacent layers of the corpora cavernosal sinusoids. The function of Shh and BMP-4 is to establish and maintain corpora cavernosal sinusoids. The data suggest that Ptc and Hoxa-10 are also important in penile morphogenesis. The continuing function of Shh and targets of its signaling in maintaining penile homeostasis in the adult is significant because disruption of Shh signaling affects erectile function. This is the first report that demonstrates the significant role that Shh plays in establishing and maintaining penile homeostasis and how this relates to erectile function. These studies provide valuable insight that may be applied to improve treatment options for erectile dysfunction.

developmental biology, male reproductive tract, male sexual function, penis

INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


Preliminary evidence suggests that sonic hedgehog (Shh) cascade members are active in early embryonic patterning of the penis. Posterior Hox genes such as Hoxa-13 and Hoxd-13 have been identified in the penis, and targeted loss of their function resulted in the complete absence of external genitalia [1, 2] in the developing embryo. Other members of the Shh cascade, including Shh, bone morphogenetic protein-4 (BMP-4), and patched (Ptc) are expressed in the genital tubercle [3], the embryonic precursor of both the penis and accessory sex organs. These findings suggest Shh cascade involvement in embryonic patterning of the penis. However, penile morphogenesis and differentiation take place primarily in the postnatal period [4]. A potential role of the Shh cascade in specification and differentiation of the penis in the postnatal period has not previously been explored. We hypothesize that the Shh cascade plays a crucial role in penile differentiation and growth and that the penis utilizes signaling mechanisms similar to those of the limb and accessory sex organs for postnatal morphogenesis.

A cascade of signaling molecules that orchestrates interaction between tissue layers has been partially established in the limb, lung, gut, and accessory sex organs. This cascade consists of but is not restricted to members of diverse gene families, such as Shh, BMPs, Hox, Wnt, and the fibroblast growth factors (FGFs). Shh is a principal component of this conserved signaling pathway. It functions by regulating cellular proliferation and differentiation [5] either directly or through induction of secondary signaling molecules [6, 7]. The Hox genes are targets of Shh signaling that can mediate early patterning instructions. These genes define positional identity along the anterior/posterior axis [8–12]. Other Shh targets are BMP-4 and Ptc. BMP-4 plays a role in interdigital and interductal space formation [13, 14] and has recently been implicated as a regulator of Shh expression [15, 16]. Ptc is the transmembrane receptor for Shh [17]. It is involved in transducing the hedgehog signal and is also a transcriptional target of Shh [18]. Shh, Hoxa-10, BMP-4, and Ptc form part of a cascade of genes that regulate mesenchymal/epithelial interactions during embryogenesis. We hypothesize that the penis utilizes similar signaling mechanisms to regulate postnatal morphogenesis and differentiation.

A better understanding of signaling mechanisms that function to establish normal penile morphology may offer valuable insight into altered morphology associated with erectile dysfunction (ED). Smooth muscle and endothelial changes accompany ED resulting from diabetes mellitus [19, 20] and nerve injury after surgical intervention for prostate cancer [21]. ED is a common and devastating pathologic condition that affects 10–30 million American men (1985 figures) [22]. Treatment options for individuals with ED are only partially effective [23]. A better understanding of how penile morphology is established and maintained would significantly enhance the potential for improved treatment. With this in mind, we will examine the mechanisms that regulate penile postnatal morphogenesis and differentiation.

MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


Animal Model

Sprague-Dawley rats from Postnatal Day 4 (P4) to P120 were obtained from Charles River (Wilmington, MA). Rats were killed, and penes were harvested by sharp dissection (scalpel and scissors) and either frozen in liquid nitrogen or fixed in 4% paraformaldehyde. Animals were cared for in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals.

Cavernous Nerve Injury

P120 Sprague-Dawley rats were randomized into two groups: bilateral cavernous nerve (CN) resection (n = 14) and sham abdominal exploration (control, n = 14). Sections (5 mm) of the cavernous nerve were removed bilaterally using a KAPS industrial microscope under direct vision through a midline abdominal incision. The prostatic capsule was manipulated in control animals without resecting the CN. Stress-related fluctuations of serum testosterone were minimized at the time of abdominal exploration through bilateral epididymo-orchiectomy and s.c. placement of a 2-cm piece of medical-grade silastic tubing (Dow Corning, Midland, MI) filled with crystalline testosterone [24, 25]. This method ensures reliable, uniform serum testosterone levels for both the control and intervention groups up to 28 days after placement. Penes were harvested 7 and 21 days after CN resection and were either frozen in liquid nitrogen or fixed in 4% paraformaldehyde.

RNA Isolation and Quantification of Gene Expression by Reverse Transcription Polymerase Chain Reaction

Total RNA was extracted from penes of Sprague-Dawley rats using the TRIzol (Life Technologies, Gaithersburg, MD) method. Samples were treated with DNase (Promega, Madison, WI) to eliminate genomic DNA contamination. Primers (Table 1) were synthesized at the Northwestern University Biotechnology Facility. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the Gene Amp RNA PCR Core kit (Perkin-Elmer, Branchburg, NJ), and products were digested with restriction enzymes to confirm that bands represented the sequences of interest. Quantitative RT-PCR was performed as described previously [19, 26] using noncompetitive methodology and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein L-32 (RPL-32), or RPL-19 as endogenous internal standards. All measurements were made in the linear range for Shh and GAPDH, BMP-4 and RPL-32, Hoxa-10 and RPL-19, and Ptc and GAPDH. Assays were performed in triplicate on three sets of pooled tissue specimens, and the product ratios are reported as the mean ± SEM. The data presented for each gene were normalized to 1 so results could be presented in a comparable manner, and a t-test was used to determine significant changes in gene expression.

View this table:
[in this window]
[in a new window]
TABLE 1. Primers used for RT-PCR of rat genes

In Situ Hybridization

Penes that were fixed in 4% paraformaldehyde overnight were used for in situ hybridization as previously described [19, 27] utilizing a mouse Shh RNA probe [28], a mouse Ptc RNA probe [29], and a mouse Bmp-4 probe [30].

Immunohistochemical Analysis

Immunohistochemical analysis (IHC) was performed as previously outlined [19]. Sections were incubated with one of the following antibodies: goat polyclonal IgG Shh, Ptc, Bmp-4, and CD31 (Santa Cruz Biotechnology, Santa Cruz, CA; 200 µg/ml), Hoxa-10 (BAbCO, Richmond, CA), or alpha smooth muscle actin (Sigma, St. Louis, MO). Sections were stained with diaminobenzidine (DAB) or DAB with nickel and mounted using crystal mount (Biomedia, Foster City, CA).

Western Analysis

Western analysis was performed on CN-injured (n = 5) and control (n = 5) penes as outlined previously [19]. Membranes were incubated with a goat polyclonal Shh antibody (Santa Cruz Biotechnology; 200 µg/ml) for 18 h at 4°C. Protein bands were visualized using enhanced chemiluminescence detection reagent (ECL Western Blotting Analysis System; Amersham, Piscataway, NJ) according to the manufacturer’s directions and then exposed to Kodak (Rohester, NY) X-AR2 film for 1–5 min.

Morphology

The morpholgy of penis tissue was examined in sections stained with hematoxylin and eosin (H&E) as outlined previously [31]. Sections were dehydrated with ethanol and xylene and mounted using Krystalon (Diagnostic Systems, Gibbstown, NJ).

Bead Experiments

Affi-Gel beads (100–200 mesh; Bio-Rad Laboratories, Hercules, CA) were equilibrated with 5E1 anti-Shh antibody (1–3 µg/ml; Jessel, Hybridoma Bank, University of Iowa, Ames, IA), mouse IgG (3 µg/ml), recombinant mouse Shh peptide (7.5 µg/animal; R&D Systems, Minneapolis, MN) [28], recombinant human BMP-4 peptide (3 µg/animal; R&D Systems) [32], or recombinant mouse Noggin/Fc peptide (15 µg/animal; R&D Systems) overnight before injection into P30 (n = 25) and P120 (n = 25) rat penes. Fifty-six-day-old (n = 25) rats were also injected, but half the concentration of reagents was used. These ages were chosen for study because they represents the developmental periods before, during, and after puberty. Approximately 20–30 beads were injected into each animal. Rats were killed 7 days postinjection. Penes were harvested and fixed in 4% paraformaldehyde for sectioning. Bead technology has previously been used successfully for delivery of proteins and antibodies to target tissues [33, 34].

Intercavernosal Pressure Measurements

Affi-Gel beads soaked in Shh inhibitor (3 µg/ml; Jessel) or mouse IgG (control with beads: 3 µg/ml) overnight at 4°C were injected into the corpora cavernosa of P120 penes. Seven days after injection, the intercavernosal pressure (ICP) was measured after stimulation in control (no beads, n = 3), control with beads (n = 3), and inhibitor-treated (n = 3) penes as previously described [35]. Nerves were stimulated (intensity of 6 volts) by placing them on bipolar platinum stimulating electrodes connected to an electrical stimulator (Grass Instruments, Quincy, MA) delivering a series of square-wave pulses (1 msec duration at 30 Hz). The CN was unilaterally stimulated at a distance of 3 and 5 mm from the major pelvic ganglion. Stimulation lasted 40 sec. A resting interval of at least 5 min separated two consecutive stimulation procedures.

RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


Anatomy of the Penis

The rat penis contains three erectile cylinders: the paired larger corpora cavernosa and the smaller corpus spongiosium (Fig. 1). The corpora cavernosa are composed of a meshwork of interconnected cavernosal spaces lined by vascular endothelium and separated by trabeculae containing bundles of smooth muscle in a framework of collagen, elastin, and fibroblasts (Fig. 1).

View larger version (35K):
[in this window]
[in a new window]
FIG. 1. Rat penis in cross section. Arrows indicate significant morphologic features

Measurement of Shh Expression During Penile Development

The time course of Shh expression in the penis was measured by RT-PCR at points spanning the entire range of postnatal morphogenesis (P4–P120). During the first month after birth, Shh expression was low (Fig. 2A). Expression then increased significantly after P40 (P = 0.046), peaked at P90, and remained abundant in the adult (P120) and in aged rats (P200, data not shown). Thus, Shh was expressed in the penis during the entire period of postnatal morphogenesis, and expression remained abundant in the adult.

View larger version (37K):
[in this window]
[in a new window]
FIG. 2. Graph of the desnity of RT-PCR products versus age in the Sprague-Dawley rat. All penes assayed were between P4 and P120. Experiments were performed in triplicate on three sets of pooled tissue specimens (n = 5–10), and the data are reported as the mean ± SEM. Where error bars are absent, the error is too minimal to be distinguishable from the data point. A t-test was used to determine significant changes in expression. A) Ratio of RT-PCR products of Shh/GAPDH versus age. Shh expression in the penis is low during the first month after birth, increases during adolescence (P40–P60), peaks at P90, and remains abundant in the adult. B) Ratio of RT-PCR products of BMP-4/RPL-32 versus age. BMP-4 expression in the penis is abundant throughout the entire period of postnatal penile development (P4–P120). C) Ratio of RT-PCR products of Ptc/GAPDH versus age. Ptc expression in the penis is most abundant in the first few weeks after birth but gradually decreases with age to reach a minimum at P90. A second peak in expression occurs at P100. Expression diminishes in the adult (P120). D) Ratio of RT-PCR products of Hoxa-10/RPL-19 versus age. Hoxa-10 is most abundant in the penis immediately after birth and decreases rapidly. A second peak in Hoxa-10 expression is apparent from P40 to P60. Expression is minimal in the adult (P120)

Time Course of Expression of Shh Targets

The time courses of expression of Shh targets, including BMP-4, Ptc, and Hoxa-10, in the penis during postnatal morphogenesis (P4–P120) were measured by RT-PCR. BMP-4 was abundant during the entire period of postnatal morphogenesis, with decreased expression observed in the adult (P100–P120; Fig. 2B). Ptc expression was abundant in the first few weeks after birth (P4–P20), decreased gradually from P40 to P90, and remained abundant in the adult (P100–P120; Fig. 2C). Hoxa-10 expression was most abundant immediately after birth and decreased significantly by P40 (P < 0.05; Fig. 2D). A second peak in expression was observed between P40 and P90, and Hoxa-10 expression remained measurable in the adult (Fig. 2D).

Localization of Shh Protein During Penile Postnatal Morphogenesis

IHC was performed on juvenile (P12 and P22), adolescent (P63), and adult (P120) penes to determine Shh localization. Shh protein was faintly observed in the corpora cavernosal sinusoids and in the epithelium of the urethra at P12 (data not shown). At P22, P63, and P120 (data not shown for the adult), protein was observed in smooth muscle of the corpora cavernosal sinusoids, the epithelium of the urethra, and the nerves of the dorsal nerve bundle (Fig. 3). The endothelial lining of the sinusoids was identifiable as a thin layer of unstained tissue adjacent to the smooth muscle. These results indicate that Shh protein is restricted to specific regions of the penis during postnatal morphogenesis and in the adult.

View larger version (108K):
[in this window]
[in a new window]
FIG. 3. Analysis of juvenile (P22) and adolescent (P63) Sprague-Dawley rat penes for Shh protein and RNA. Top: IHC for Shh protein. At P22, Shh protein is visible in the smooth muscle of the corpora cavernosal sinusoids, the nerves of the dorsal nerve bundle, and the epithelium of the urethra. This localization remains unchanged in the adolescent (P63) and the adult (data not shown). DAB (with or without nickel) was used to visualize Shh protein. Arrows indicate Shh protein. N, Nerve. Magnification x40. Bottom: In situ hybridization analysis for Shh RNA in the juvenile (P22) and adolescent (P63) rat. Shh is expressed in the smooth muscle of the corpora cavernosal sinusoids and the epithelium of the urethra and faintly in the nerves. The endothelial lining of the corpora cavernosal sinusoids is apparent as a thin layer adjacent to the smooth muscle (asterisk); it did not stain for Shh RNA. Arrows indicate Shh RNA. N, Nerve. Magnification x40

Localization of Shh RNA by In Situ Hybridization

Localization of Shh in the penis was also examined by in situ hybridization (P12, P22, P63, and P120). Shh RNA was abundant in the smooth muscle of the corpora cavernosal sinusoids and in the epithelium of the urethra at all ages assayed (Fig. 3, bottom; P12 and P120 data not shown). Contrary to observations made for Shh protein, little Shh RNA was observed in the nerves of the dorsal nerve bundle. However, in the nerve cell body, the pelvic ganglia, Shh was abundant (data not shown). These results confirm IHC findings of restricted Shh protein distribution.

Shh Protein in the Nerves and Corpora Cavernosa May Be Related

Western analysis was performed on control and CN-injured penes to examine a possible realtionship between the presence of Shh protein in the nerves of the dorsal nerve bundle and in the corpora cavernosa. Shh protein was dramatically decreased in the penis (no longer detectable) 7 days after CN injury (Fig. 4A). IHC analysis revealed the absence of Shh protein in the corpora cavernosa 21 days after CN injury (Fig. 4B). These results show that the presence of Shh protein in the nerves and corpora cavernosa of the penis are related. However, the nature of this relationship remains to be determined.

View larger version (76K):
[in this window]
[in a new window]
FIG. 4. Analysis of Shh protein in control and CN-injured Sprague-Dawley rat penes. A) In Western blots, Shh protein is no longer detectable in the penis 7 days after CN injury. C, Control; CN7, 7 days after CN injury. B) Twenty-one days after CN injury, Shh protein is no longer detectable by IHC in the smooth muscle of the corporal cavernosal sinusoids. Arrows indicate Shh protein or where Shh protein would be if present. Magnification x20.

Localization of Shh Targets in the Penis During Development

The localization of BMP-4, Ptc, and Hoxa-10 proteins was examined by IHC in juvenile (P12 and P30), adolescent (P63), and adult (P90) penes (n = 3 for each age group). BMP-4 protein was restricted to the endothelial lining of the corpora cavernosal sinusoids, whereas Ptc and Hoxa-10 were localized in the adjacent smooth muscle of the sinusoids and in the epithelium of the urethra (Figs. 5 and 6; data not shown for P12 and P90). Shh, Ptc, BMP-4, and Hoxa-10 were all localized in close proximity (in adjacent tissue layers) in the corpora cavernosa of the penis.

View larger version (146K):
[in this window]
[in a new window]
FIG. 5. IHC of juvenile Sprague-Dawley rat (P30) penes assayed for BMP-4, Ptc, and Hoxa-10 proteins. Top: BMP-4 protein is restricted to the endothelial lining of the corpora cavernosal sinusoids and is not visible in the nerves of the dorsal nerve bundle or the urethra. The smooth muscle of the sinusoid is visible as an unstained layer adjacent to the endothelium. Middle: Ptc protein is localized in the smooth muscle of the corpora cavernosal sinusoids and the epithelium of the urethra. It is not visible in the nerves of the dorsal nerve bundle. Bottom: Hoxa-10 protein is localized in the smooth muscle of the corpora cavernosal sinusoids and faintly in the epithelium of the urethra. It is not visible in the nerves of the dorsal nerve bundle. Arrows indicate BMP-4, Ptc, and Hoxa-10. N, Nerve. Magnification x40.

Effect of Shh Inhibitor on Postnatal Penile Morphology

Shh inhibitor (5E1 anti-Shh antibody), a recombinant Shh peptide, and mouse IgG (control) were preabsorbed into Affi-Gel beads and injected into the corpora cavernosa of P56 penes to examine what role Shh may play in penile postnatal morphogenesis. H&E staining revealed a meshwork of corpora cavernosal sinusoids (Fig. 7) that looked normal despite the presence of Affi-Gel beads used to deliver the mouse IgG (control). Shh inhibitor treatment (1.5 µg/ml) resulted in gross abnormalities, including the absence of corpora cavernosal sinusoids in the affected region (Fig. 7). The resulting corpora cavernosal tissue resembled the undifferentiated tissue of the newborn (data not shown). These experiments were repeated in P30 and P120 animals (juvenile and adult, respectively) and with double the inhibitor concentration (3 µg/ml). A similar but stronger response was observed (data not shown); a larger region of the corpora was affected, and corpora cavernosal sinusoids were completely absent over a larger cross section of the penis. The presence of a dose-dependent change in morphology that was observed at several different ages indicates the importance of Shh function to penile postnatal morphogenesis and adult homeostasis.

View larger version (142K):
[in this window]
[in a new window]
FIG. 7. H&E staining of control (mouse IgG), 5E1 Shh inhibitor-treated, and recombinant Shh peptide-treated corpora cavernosa of the adolescent (P63) Sprague-Dawley rat. HE staining. Gross evaluation (6x) reveals abundant corpora cavernosal sinusoids in control penes. After inhibitor treatment, sinusoids are almost completely absent. The corporal tissue resembles that of the undifferentiated newborn penis (20x). After exogenous Shh peptide treatment, an increase in differentiated endothelial tissue is visible surrounding the beads. Arrows indicate Affi-Gel beads

Effect of Shh Inhibitor on Targets of Shh Signaling

The effects of Shh inhibition on members of the Shh cascade, including BMP-4, Ptc, and Hoxa-10, were examined by IHC. After inhibitor treatment, Shh protein was not observed in the corpora cavernosa near the bead vehicles (Fig. 8), thus confirming that the inhibitor was effective. BMP-4 protein was dramatically increased, but Ptc and Hoxa-10 proteins were completely absent after inhibitor treatment (Fig. 8). Shh inhibition experiments were repeated in juvenile and adult animals at a higher inhibitor concentration. BMP-4 and Ptc RNA and protein were dramatically increased (Fig. 9A). The increase in Ptc RNA distribution was not observed at the lower concentration of inhibitor (Fig. 8). When inhibitor-treated beads were injected in the dorsal nerve bundle, a similar increase in BMP-4 expression was observed immediately surrounding the nerves (Fig. 9B). These results demonstrate a concentration-dependent effect of Shh inhibitor on expression of Shh targets.

View larger version (121K):
[in this window]
[in a new window]
FIG. 8. IHC of control (mouse IgG), Shh inhibitor-treated, and Shh peptide-treated Sprague-Dawley rat penes assayed for Shh, BMP-4, Ptc, Hoxa-10, alpha actin, and CD31 proteins. Left: All of these proteins are present in the corpora cavernosa of normal penes. Middle: After inhibitor treatment, Shh protein is absent in the treated area of the corpora, thus confirming inhibitor function. BMP-4 protein localization is dramatically increased a short distance from the bead vehicle and Ptc and Hoxa-10 are downregulated after Shh disruption. Staining for alpha actin and CD31 is completely absent in the affected region. Arrows indicate Affi-Gel beads and the area treated with inhibitor. Right: After addition of exogenous Shh peptide, staining for Shh protein is abundant around the bead vehicles, thus confirming treatment with Shh peptide. In contrast to inhibitor treatment, Shh peptide treatment resulted in the absence of BMP-4 protein and an increase in localization of Ptc, Hoxa-10, and CD31. Alpha actin is faintly visible in a diffuse region surrounding the beads. Arrows indicate protein localization. +, Absence of protein; -, presence of protein. Magnification x6

Morphological Markers Assayed by IHC after Shh Inhibitor Treatment

Corpora cavernosal morphology was evaluated after Shh inhibitor treatment by IHC analysis of smooth muscle (alpha actin) and endothelium (CD31). Gross changes in penile morphology were observed. Normal penes stained abundantly for both alpha actin and CD31 (Fig. 8). Alpha actin was observed both in the sinusoid smooth muscle and in individual cells interspersed between the trabeculae (data not shown). After Shh inhibition, the corpora cavernosa was completely devoid of both cell types in the affected region. Visual inspection of the affected tissue revealed abundant undifferentiated mesenchyme. These results show that inhibition of Shh function resulted in a dedifferentiation of the penile corpora such that smooth muscle and endothelium were absent and primitive mesenchyme was abundant.

Effect of Exogenous Shh Peptide on Penile Morphology

P56 penes were treated with exogenous Shh peptide and mouse IgG (control) using Affi-Gel beads to gain further insight into Shh function. The results were very different from those observed after treatment with Shh inhibitor. Cavernosal sinusoids were absent in H&E-stained sections (Fig. 7), but IHC analysis revealed that the tissue was “filled in” with an abundance of cells that stained positively for CD31 and only faintly for alpha actin (Fig. 8). Thus, Shh peptide and inhibitor had opposing effects, with inhibition of function resulting in dedifferentiation and addition of exogenous peptide causing increased endothelial differentiation.

Targets of Shh signaling also were examined after Shh peptide treatment. BMP-4 protein was completely absent, but Ptc and Hoxa-10 proteins were upregulated in the region surrounding the beads (Fig. 8). To ensure that the method of delivery was working, we used IHC to assay Shh protein. Shh was observed in the tissue surrounding the bead vehicles (Fig. 8). These results demonstrate that Shh is a mediator of differentiation in the penis and imply a function for Shh targets in postnatal penile morphogenesis.

Effect of Exogenous BMP-4 Peptide on Penile Morphology

The potential role of BMP-4 in penile postnatal morphogenesis was examined in the penis because BMP-4 localization was profoundly altered by the presence/absence of Shh function. Affi-Gel beads pretreated with recombinant BMP-4 peptide, recombinant Noggin peptide (antagonist of BMP-4), or mouse IgG (control) were injected into P56 rats. H&E staining after BMP-4 peptide treatment revealed an increase in size of the corpora cavernosal sinusoids (Fig. 10), which appeared normal in all other aspects (intact endothelial lining and blood cells within the sinusoids). IHC analysis revealed increased CD31 and Ptc proteins surrounding the beads but an absence of Shh and alpha actin proteins (Fig. 11). BMP-4 protein was identified around the beads after exogenous BMP-4 treatment, confirming peptide delivery. Thus, BMP-4 appears to downregulate Shh and upregulate Ptc.

View larger version (143K):
[in this window]
[in a new window]
FIG. 10. H&E analysis of control (mouse IgG), recombinant BMP-4 peptide-treated, and recombinant Noggin-treated corpora cavernosa from Sprague-Dawley rats (P63). Top: Gross evaluation (6x) reveals abundant corpora cavernosal sinusoids in control penes. Middle: After BMP-4 treatment, sinusoidal spaces are larger upon visual observation (20x). The increased size is not an artifact of sectioning because sinusoids have a normal appearance, with an intact endothelial lining and blood cells identifiable within the sinusoids. Bottom: After Noggin treatment (BMP-4 antagonist), sinusoids are absent in the treated area and abundant endothelium is evident. Arrows indicate Affi-Gel beads

Opposing effects of BMP-4 and Noggin were observed in the corpora cavernosa. Noggin treatment resulted in a dramatic decrease in the number of sinusoids (Fig. 10) in the corpora cavernosa in a manner similar to that observed after the addition of Shh peptide. IHC analysis revealed normal CD31 staining, the absence of alpha actin and Ptc proteins, and an abundance of Shh protein near the beads (Fig. 11). IHC analysis for BMP-4 protein revealed the absence of BMP-4 after Noggin treatment, confirming antagonist delivery (Fig. 11). These results indicate that BMP-4 is necessary to establish normal corpora cavernosal morphology in the adolescent penis.

ICP Measurement

ICP was measured in adult rats that had been either treated with Shh inhibitor, mouse IgG (bead control) or were left untreated (control). The presence of the bead vehicle did not alter the maximum pressure attained after stimulation (Fig. 12). However, the presence of Shh inhibitor dramatically decreased the ICP. These experiments demonstrate that inhibition of Shh function can alter corpora cavernosal morphology enough to result in ED.

View larger version (17K):
[in this window]
[in a new window]
FIG. 12. ICP measurement in control (untreated), mouse IgG (control with beads), and Shh inhibitor-treated adult (P120) Sprague-Dawley rat penes after electrical stimulation of the CN for 40 sec. Seven days after treatment, the presence of the bead vehicle has not altered the maximum pressure attained after stimulation. However, the presence of Shh inhibitor dramatically decreased the ICP

DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


To make complex structures such as the penis from undifferentiated precursor cells, both proliferation and organization (patterning) are necessary, requiring coordinated activity of multiple signals to achieve the proper arrangement of adult tissues. Shh, Ptc, BMP-4, and Hoxa-10 form a small part of a cascade that acts coordinately to achieve postnatal penile morphogenesis and differentiation. These genes are abundant in the penis after birth, and their localization in the smooth muscle and endothelial lining of the corpora cavernosal sinusoids implies their involvement in differentiation of the sinusoidal tissue. This hypothesis was examined by inhibiting Shh function in targeted regions of the corpora cavernosa. This inhibition resulted in gross anatomical changes in corpora cavernosal morphology, including the absence of sinusoids and the presence of large amounts of undifferentiated tissue closely resembling the primitive architecture of the neonate (unpublished observations). We confirmed the absence of differentiated smooth muscle and endothelium by IHC (Fig. 8). The observed morphological changes are not likely to be artifacts attributable simply to the presence of the bead vehicle because the morphology of the controls was completely normal despite the presence of Affi-Gel beads. Administration of inhibitor in the juvenile, adolescent, and adult rat resulted in strikingly similar changes in morphology and thus provided evidence that Shh is not only required to establish penile morphology but continues to function in the adult to maintain corpora cavernosal homeostasis. How Shh acts to induce and maintain sinusoid structure is not yet clear; however, clues to its function were obtained after treatment with exogenous Shh peptide, which disrupted the balance of proliferation to favor terminal differentiation into endothelial cells. Shh is normally localized in the smooth muscle of the corporal sinusoids (Fig. 3) adjacent to the endothelium. Shh may exert its influence directly on the endothelium of the sinusoids or through induction of targets in the adjacent endothelium (BMP-4).

Other members of the Shh cascade are required for establishing normal penile morphology. This requirement was first suspected when we disrupted Shh signaling, resulting in dramatic and consistent changes in expression of Shh targets (most notably of BMP-4). The role of BMP-4 in penile differentiation was confirmed by treatment of the corpora cavernosa with recombinant BMP-4 protein or a BMP-4 antagonist (Noggin). BMP-4 protein treatment resulted in corpora cavernosal sinusoids that were large but otherwise normal (lined by endothelium and containing blood cells visible within the interior). The enlarged sinusoids were unlikely to be an artifact of the sectioning process because a normal endothelial lining was visible inside the enlarged cavernae. Likewise, morphological changes could not be attributed to the presence of the bead vehicle because control corpora cavernosa appeared normal. Treatment with Noggin resulted in the absence of sinusoids and increased endothelial tissue surrounding the beads. This result was very similar to that obtained after Shh protein administration and is consistent with elevated Shh expression surrounding the Noggin-treated beads (Fig. 11). Our experimental findings indicate that BMP-4 plays a crucial role in establishing normal sinusoid morphology in the penile corpora cavernosa and that at least one other member of the Shh cascade is essential for postnatal morphogenesis of the penis.

Clues to how the Shh cascade regulates sinusoid differentiation were gleaned when we disrupted Shh cascade function. Disruption of either Shh or BMP-4 signaling significantly increased expression of the other (inverse relationship). Many researchers have suggested that Shh and BMP-4 expression are related, but the exact nature of this relationship remains controversial. For example, Shh-producing cells grafted to the neural tube inhibited BMP-4 expression during neural tube development [36], and inhibition of BMP-4 expression by Shh was also observed in somite patterning [37]. In other studies, BMP-4 repressed Shh expression in dental epithelium [38] and during hair growth induction [39]. The relationship between Shh and BMP-4 clearly is complex, and both BMP-4 and Shh proteins have the ability to negatively regulate each other’s transcription [16]. The process of penile differentiation also is complex and most likely involves other factors that have yet to be determined. In our studies of the penis, Shh and BMP-4 were expressed in adjacent layers of the sinusoid, they negatively regulated each other’s expression, and they had different effects on sinusoid morphogenesis. In addition, both Shh and BMP-4 were able to induce Ptc expression and to increase endothelial differentiation. The results presented here define a functional role for Shh cascade members in penile postnatal morphogenesis and suggest some of the regulatory mechanisms involved in this process.

Shh protein localization in neural tissue was unique among the developmental genes assayed. Contrary to observations made with Shh protein, little Shh RNA was observed in the nerves of the dorsal nerve bundle; however, Shh RNA was abundant in the nerve cell body, the pelvic ganglia (data not shown). Because RNA synthesis is not possible in the nerve axon, it is likely that little Shh RNA travels down the nerve from the cell body to reside in the dorsal nerve bundle. Shh protein is not restricted in this manner. It is made in the pelvic ganglia but can easily travel down the axons to reside in the nerves of the dorsal nerve bundle. A potential connection between Shh signaling in the nerves and its expression in the corpora cavernosal sinusoids has been examined using rats with experimentally induced CN injury. Severing the nerves bilaterally resulted in decreased Shh protein in the smooth muscle of the corpora cavernosal sinusoids and extensive morphological changes, including altered expression of endothelial and smooth muscle markers [21], increased apoptosis [40], and ED (Fig. 12). The Shh cascade acts to establish normal penile morphology. Nerve injury disrupts the Shh cascade and corpora cavernosal homeostasis such that morphological changes in sinusoid structure ensue. ED can result when Shh signaling is abrogated. This is the first study demonstrating the significant role that Shh plays in establishing and maintaining penile homeostasis and how this relates to erectile function.

Shh, BMP-4, Ptc, and Hoxa-10 form part of a regulatory cascade that is essential for postnatal morphogenesis and differentiation of the penis. The function of Shh and BMP-4 is to establish and maintain corporal sinusoids. The data suggest that Ptc and Hoxa-10 are also important in penile morphogenesis. The continuing function of Shh and of the targets of its signaling in maintaining penile homeostasis in the adult is important because disruption of Shh signaling affects erectile function. Thus, these observations have potential application to disease states that impact erectile function.

ACKNOWLEDGMENTS

The authors thank Andrew McMahon, Matthew Scott, and Brigid Hogan for supplying Shh, Ptc, and BMP-4 constructs, respectively, to synthesize riboprobes, Alfred Rademaker for assistance with statistical analysis, Michael Pins for help in differentiating penile morphology, and Philip Hockberger for aid in manuscript preparation.

FOOTNOTES

1 This work was sponsored by the National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Diseases under grants DK54478, DK55046, and DK59071.

2 Correspondence: Carol Podlasek, Department of Urology, Northwestern University, Tarry Building 11-715, 303 E. Chicago Ave., Chicago, IL 60611. FAX: 312 908 7275; cap325@northwestern.edu

Received: 2 May 2002.

First decision: 27 May 2002.

Accepted: 22 August 2002.

REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Kondo T, Zákány J, Innis JW, Duboule D. Of fingers, toes and penises. Nature 1997 390:29[Medline]
Dollé P, Izpisua-Belmonte J, Boncinelli E, Duboule D. The Hox4.8 gene is localized at the 5’ extremity of the Hox-4 complex and is expressed in the most posterior parts of the body during development. Mech Dev 1991 36:3-13[Medline]
Haraguchi R, Mo R, Hui C, Motoyama J, Makino S, Shiroishi T, Gaffield W, Yamada G. Unique functions of Sonic hedgehog signaling during external genitalia development. Development 2001 128:4241-4250[Abstract/Free Full Text]
Leeson TS, Leeson CR. Penile cavernous tissue: an electron microscopic study of its development in the rat. Acta Anat (Basel) 1966 63:404-417[Medline]
Duprez D, Fournier-Thibault C, Le Douarin N. Sonic hedgehog induces proliferation of committed skeletal muscle cells in the chick limb. Development 1998 125:495-505[Abstract/Free Full Text]
Roberts DJ, Johnson RL, Burke AC, Nelson CE, Morgan BA, Tabin C. Sonic hedgehog is an endodermal signal inducing BMP-4 and Hox genes during induction and regionalization of the chick hindgut. Development 1995 121:3163-3174[Abstract/Free Full Text]
Drossopoulou G, Lewis KE, Sanz-Ezquerro JJ, Nikbakht N, McMahon AP, Hofman C, Tickle C. A model for anteroposterior patterning of the vertebrate limb based on sequential long- and short-range Shh signalling and Bmp signalling. Development 2000 127:1337-1348[Abstract/Free Full Text]
Papageorgiou S, Almirantis Y. Gradient model describes the spatial-temporal expression pattern of Hoxa genes in the developing vertebrate limb. Dev Dyn 1996 207:461-469[Medline]
Dollé P, Izpisua-Belmonte JC, Brown JM, Tickle C, Duboule D. Hox-4 genes and the morphogenesis of mammalian genitalia. Genes Dev 1991 5:1767-1776[Abstract]
Podlasek CA, Duboule D, Bushman W. Male accessory sex organ morphogenesis is altered by loss of function of Hoxd-13. Dev Dyn 1997 208:454-465[Medline]
Podlasek CA, Clemens JQ, Bushman W. Hoxa-13 gene mutation results in abnormal seminal vesicle and prostate development. J Urol 1999 161:1655-1661[Medline]
Podlasek CA, Seo RM, Clemens JQ, Ma L, Maas RL, Bushman W. Hoxa-10 deficient male mice exhibit abnormal development of the accessory sex organs. Dev Dyn 1999 214:1-12[Medline]
Tang MK, Leung AK, Kwong WH, Chow PH, Chan JY, Ngo-Muller V, Li M, Lee KK. Bmp-4 requires the presence of the digits to initiate programmed cell death in interdigital tissues. Dev Biol 2000 218:89-98[Medline]
Lamm MLG, Podlasek CA, Barnett DH, Lee J, Clemens JQ, Hebner CM, Bushman W. Mesenchymal factor bone morphogenetic protein-4 restricts ductal budding and branching morphogenesis in the developing prostate. Dev Biol 2001 232:301-314[Medline]
Zhao X, Zhang Z, Song Y, Zhang X, Zhang Y, Hu Y, Fromm SH, Chen Y. Transgenically ectopic expression of Bmp4 to the Msx1 mutant dental mesenchyme restores downstream gene expression but represses Shh and Bmp2 in the enamel knot of wild type tooth germ. Mech Dev 2000 99:29-38[Medline]
Monsoro-Burq A, Le Douarin NM. BMP4 plays a key role in left-right patterning in chick embryos by maintaining Sonic hedgehog asymmetry. Mol Cell 2001 7:789-799[Medline]
Marigo V, Davey RA, Zuo Y, Cunningham JM, Tabin CJ. Biochemical evidence that patched is the hedgehog receptor. Nature 1996 384:176-179[Medline]
Marigo V, Tabin CJ. Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci U S A 1996 93:9346-9351[Abstract/Free Full Text]
Podlasek CA, Zelner DJ, Bervig TR, Gonzalez CM, McKenna KE, McVary KT. Characterization and localization of NOS isoforms in the BB/WOR diabetic rat. J Urol 2001 166:746-755[Medline]
Simopoulos DN, Gibbons SJ, Malysz J, Szurszewski JH, Farrugia G, Ritman EL, Moreland RB, Nehra A. Corporeal structural and vascular micro architecture with x-ray micro computerized tomography in normal and diabetic rabbits: histopathological correlation. J Urol 2001 165:1776-1782[Medline]
Podlasek CA, Gonzalez CM, Zelner DJ, Jiang HB, McKenna KE, McVary KT. Analysis of NOS isoform changes in a post radical prostatectomy model of erectile dysfunction. Init J Impot Res 2001 13:suppl 5S1-S15
Feldman HA, Goldstein I, Hatzichristou DG, Krane RJ, McKinlay JB. Impotence and its medical and psychosocial correlates: results of the Massachusetts male aging study. J Urol 1994 151:54-61[Medline]
Vale J. Erectile dysfunction following radical therapy for prostate cancer. Radiother Oncol 2000 57:301-305[Medline]
Dziuk PJ, Cook B. Passage of steroids through silicone rubber. Endocrinology 1966 78:208-211[Medline]
Stratton LG, Ewing LL, Desjardins C. Efficacy of testosterone-filled polydimethylsiloxane implants maintaining plasma testosterone in rabbits. J Reprod Fertil 1973 35:235-244[Medline]
Seibert P. Clontech Methods and Applications, book 3. Palo Alto, CA: Clontech Laboratories; 1993: 17–21
Komminoth P. Roche Molecular Biochemicals Nonradioactive In Situ Hybridization Application Manual. Mannheim: Boehringer Mannheim GmbH; 1996: 122–152
Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 1993 75:1417-1430[Medline]
Goodrich LV, Johnson RL, Milenkovic L, McMahon JA, Scott MP. Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a mouse patched gene by hedgehog. Genes Dev 1996 10:301-312[Abstract]
Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 1996 122:1693-1702[Abstract/Free Full Text]
Sheehan DC, Hrapchak BB. Theory and Practice of Histotechnology, 2nd ed. St. Louis: CV Mosby; 1980: 141–154
Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM, Wang EA. Novel regulators of bone formation: molecular clones and activities. Science 1988 242:1528-1534[Medline]
Yang Y, Drossopoulou G, Chuang PT, Duprez D, Marti E, Bumcrot D, Vargesson N, Clarke J, Niswander L, McMahon A, Tickle C. Relationship between dose, distance and time in sonic hedgehog-mediated regulation of anteroposterior polarity in the chick limb. Development 1997 124:4393-4404[Abstract/Free Full Text]
Podlasek CA, Barnett DH, Clemens JQ, Bak PM, Bushman W. Prostate development requires sonic hedgehog expressed by the urogenital sinus epithelium. Dev Biol 1999 209:28-39[Medline]
Giuliano F, Rampin O, Bernabé J, Rousseau JP. Neural control of penile erection in the rat. J Auton Nerv Syst 1995 55:36-44[Medline]
Watanabe Y, Duprez D, Monsoro-Burq AH, Vincent C, Le Douarin NM. Two domains in vertebral development: antagonistic regulation by SHH and BMP4 proteins. Development 1998 125:2631-1639[Abstract/Free Full Text]
Hirsinger E, Duprez D, Jouve C, Malapert P, Cooke J, Pourquie O. Noggin acts downstream of Wnt and sonic hedgehog to antagonize BMP4 in avian somite patterning. Development 1997 124:4605-4614[Abstract/Free Full Text]
Zhang Y, Zhang Z, Zhao X, Yu X, Hu Y, Geronimo B, Fromm SH, Chen YP. A new function of BMP4: dual role for BMP4 in regulation of sonic hedgehog expression in the mouse tooth germ. Development 2000 127:1431-1443[Abstract/Free Full Text]
Botchkarev VA, Botchkareva NV, Nakamura M, Huber O, Funa K, Lauster R, Paus R, Gilchrest BA. Noggin is required for induction of the hair follicle growth phase in postnatal skin. FASEB J 2001 15:2205-2214[Abstract/Free Full Text]
User HM, Hairston JC, Zelner DJ, McKenna KE, McVary KT. Penile weight and cell subtype specific changes in a post radical prostatectomy model of erectile dysfunction. J Urol 2002 (in press) .

From post 71:

GENE TRANSFER OF INDUCIBLE NITRIC OXIDE SYNTHASE cDNA REGRESSES
THE FIBROTIC PLAQUE IN AN ANIMAL MODEL OF PEYRONIE’S DISEASE
Hugo H. Davila1,2, Thomas R. Magee1,2, Dolores Vernet2, Jacob Rajfer1,2 and Nestor F.
Gonzalez-Cadavid1,2

It’s great that we’re all posting the text of these papers, but I think it’s created a new problem—excessive length.

Perhaps one of the mods would kindly consider reposting some of the above submissions with studies provided as attached text files rather than as embedded text. I’d volunteer to do it myself, but I don’t have the privileges.

I kind of hate the location of my full texts. If at some point a friendly moderator could put them with their respective posts, I think it would be better for the flow of conversation.

IOW, I feel like I just put up a wall.

Also, can this post be deleted once a decision is made, one way or the other?

edit: MM beat me to it.

If you can’t put them with the respective posts, maybe you can move the block a page back or so?

Or a separate thread you could link to, that had all the texts in it.

The length is OK, using the quote function to quote the entire text in the very next reply is a bit much. If you want to seperate your words from the cut and paste part, use the bold or italic code.

Yes, length is good. :thumbs: :chuckle:

You could also link to the posts with a lot of text rather than quote it in your new post.

Unless of course you are quoting a small portion from one.

Click the link for the pretty pictures:

Collagen

Your Most Plentiful Protein
About one quarter of all of the protein in your body is collagen. Collagen is a major structural protein, forming molecular cables that strengthen the tendons and vast, resilient sheets that support the skin and internal organs. Bones and teeth are made by adding mineral crystals to collagen. Collagen provides structure to our bodies, protecting and supporting the softer tissues and connecting them with the skeleton. But, in spite of its critical function in the body, collagen is a relatively simple protein.

The Collagen Triple Helix
Collagen is composed of three chains, wound together in a tight triple helix. The illustration included here shows only a small segment of the entire molecule—each chain is over 1400 amino acids long and only about 20 are shown here. A repeated sequence of three amino acids forms this sturdy structure. Every third amino acid is glycine, a small amino acid that fits perfectly inside the helix. Many of the remaining positions in the chain are filled by two unexpected amino acids: proline and a modified version of proline, hydroxyproline. We wouldn’t expect proline to be this common, because it forms a kink in the polypeptide chain that is difficult to accommodate in typical globular proteins. But, as you can see on the next page, it seems to be just the right shape for this structural protein.

Vitamin C
Hydroxyproline, which is critical for collagen stability, is created by modifying normal proline amino acids after the collagen chain is built. The reaction requires vitamin C to assist in the addition of oxygen. Unfortunately, we cannot make vitamin C within our bodies, and if we don’t get enough in our diet, the results can be disastrous. Vitamin C deficiency slows the production of hydroxyproline and stops the construction of new collagen, ultimately causing scurvy. The symptoms of scurvy—loss of teeth and easy bruising— are caused by the lack of collagen to repair the wear-and-tear caused by everyday activities.

Collagen on the Grocery Shelf
Collagen from livestock animals is a familiar ingredient for cooking. Like most proteins, when collagen is heated, it loses all of its structure. The triple helix unwinds and the chains separate. Then, when this denatured mass of tangled chains cools down, it soaks up all of the surrounding water like a sponge, forming gelatin.

A special amino acid sequence makes the tight collagen triple helix particularly stable. Every third amino acid is a glycine, and many of the remaining amino acids are proline or hydroxyproline. A classic triple helix is shown here, and may be viewed in the PDB file 1cag. Notice how the glycine forms a tiny elbow packed inside the helix, and notice how the proline and hydroxyproline smoothly bend the chain back around the helix. In this structure, the researchers placed a larger alanine amino acid in the position normally occupied by glycine, showing that it crowds the neighboring chains.

This collagen helix contains a segment of human collagen, and may be viewed in the PDB file 1bkv. Notice that the top half is very uniform, where the sequence is the ideal mixture of glycine and prolines. At the bottom, the helix is less regular, because many different amino acids are placed between the equally-spaced glycines.
These illustrations were created in RasMol. You can create similar pictures by clicking on the PDB codes above and then picking “View Structure”.

We make many different kinds of collagen, which form long ropes and tough sheets that are used for structural support in mature animals and as pathways for cellular movement during development. All contain a long stretch of triple helix connected to different types of ends. The simplest is merely a long triple helix, with blunt ends. These “type I” collagen molecules associate side-by-side, like fibers in a rope, to form tough fibrils. These fibrils crisscross the space between nearly every one of our cells.
This illustration depicts a basement membrane, which forms a tough surface that supports the skin and many organs. A different collagen—“type IV”—forms the structural basis of this membrane. Type IV collagen has a globular head at one end and an extra tail at the other. The heads bind strongly together, head-to-head, and four collagen molecules associate together through their tails, forming an X-shaped complex. Using these two types of interactions, type IV collagen forms an extended network, shown here in light blue. Two other molecules—cross-shaped laminin (blue- green) and long, snaky proteoglycans (green)—fill in the spaces, forming a dense sheet.

I was reading around a bit, and I’d like to toss this out as a another possible reason why gains slow rather than simply fibrosis.

Slowing Gains Theory
“I have a theory that the quick early gains are due to maximizing the existing tissue
and further gains must be from actual stretching and hyperplasia or hypertrophy of the tissues.
This is a slower process and would require a very disciplined routine to force.”~NotEnough

Proc Natl Acad Sci U S A. 2002 February 5; 99 (3): 1101–1103
DOI: 10.1073/pnas.042707899

Commentary

Unstable molecules form stable tissues
Anton V. Persikov and Barbara Brodsky*

Department of Biochemistry, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, NJ 08854

* To whom reprint requests should be addressed. E-mail: brodsky@umdnj.edu.

See companion article on page 1314 .

Top
References


Collagens are major structural proteins in the extracellular matrix, making up about one-third of protein mass in higher animals. In addition to their sheer bulk, this protein family is of interest because of their diversity of structural and morphogenetic roles and the attribution of an increasing number of hereditary diseases to mutations in collagens (1–4). All collagens have a distinctive molecular conformation: a triple-helix composed of three supercoiled polyproline II-like helical chains (5–7). This triple-helical conformation places strict constraints on amino acid sequence, requiring Gly as every third residue and a high content of proline and hydroxyproline residues. There are more than 20 distinct genetic types of collagens, and the most abundant are types I, II, and III, found in fibrils with a characteristic 67-nm axial period (1). Type I collagen, a heterotrimer composed of two α1(I) chains and one α2(I) chain, forms the prominent fibrils in tendon, bone, and cornea, whereas type III collagen, a disulfide-linked homotrimer, is found together with type I in fibrils of blood vessels and skin. These fibril-forming collagens are synthesized in a procollagen form, with globular propeptides on each end of a central triple-helix (Fig. 1; ref. 3). Self-association and disulfide cross-linking of three C-propeptides are responsible for the initial events of chain selection and trimer formation, whereas subsequent events include nucleation and zipper-like folding of the triple-helix domain (8). After cleavage of the propeptides, the rod-like triple-helical molecules in the matrix self-associate in a staggered array, forming fibrils and interacting with other matrix molecules to provide the strength, flexibility, or compression required for each tissue. Collagen fibers are inherently stable structures, having lifetimes of at least 6 months, and often much longer. Turnover is accomplished through a specialized family of tightly regulated matrix metalloproteinases, because triple-helices are resistant to digestion by most proteases (9).

Even though collagen fibers are long-lived structures, the stability of their constituent collagen molecules is marginal with respect to physiological temperature (10). When heated in physiological buffers, collagen molecules spontaneously self-associate, but if fibril formation is prevented, through use of glycerol or low pH, collagen molecules undergo a thermal transition, from triple-helical trimers to unfolded monomers. For mammals and birds, this denaturation temperature (Tm) appears to be a few degrees higher than body temperature, whereas the Tm correlates with the upper environmental temperature for poikilotherms (10). For example, the Tm of human type I collagen, as determined spectrophotometrically or by proteolytic digestion, is typically cited as approximately 41.5°C (11–13), whereas that from the skin of an ice fish is 6°C (10). This variation in Tm appears to be mediated through the hydroxyproline content, although there is increasing evidence that other amino acids may also play a role (14, 15). The correlation between Tm and body temperature was rationalized as ensuring sufficient stability for collagen molecules before incorporation into fibrils, while allowing sufficient mobility for fiber formation and turnover. In this issue of PNAS, Leikina et al. (16) turn the current paradigm on its head and conclude that collagen molecules, which are so important for long-term stability of tissues, are not themselves stable at body temperature. By using extremely slow calorimetry, together with isothermal circular dichroism spectroscopy, the preferential state for type I collagen at body temperature is demonstrated to be random coil rather than a triple helix. After almost half a century of studies, can it be true that collagen molecules are unstable at physiological temperatures, and if so, is it of biological relevance?

Type I collagen is a particularly difficult system for attaining reversibility.

Determination of collagen stability is not straightforward. Equilibrium thermodynamics has been used successfully to study denaturation of small globular proteins (17). However, it has proved problematic to apply this theory to the denaturation of collagen, despite its apparent structural simplicity. First, unfolding of collagen molecules does not follow a simple two-state model. The larger value of the calorimetric enthalpy compared with the van’t Hoff enthalpy is indicative of the presence of several cooperative units (18). Second, the system is extremely slow to reach equilibrium (19–22). The lack of equilibrium is indicated by hysteresis observed when refolding curves do not retrace unfolding curves (21, 23), the strong dependence of the melting temperature on the heating rate (16), and calorimetric irreversibility (24–26). In 1967, von Hippel noted that “of all macromolecules studied extensively to date, the collagen-gelatin system exhibits by far the slowest rate of helix-coil conversion,” a process he described as “agonizingly” slow, on the time scale of hours, days, or even longer (19). Such difficulty in reaching equilibrium is observed for guanidinium hydrochloride-induced, as well as thermal, unfolding and refolding (21, 23). Factors that may contribute to such slow equilibration include association/dissociation for non-cross-linked chains; cis-trans isomerization of the numerous imino acids; misfolding/misalignment of long chains; and the limited conformational mobility at temperatures below Tm (16, 19, 21). Type I collagen, the system studied by Leikina et al. (16), is a particularly difficult system for attaining reversibility. After cleavage of its propeptides, type I collagen is not cross-linked. Then, refolding requires chain association to form triple-helices, and its original heterotrimeric nature cannot be recreated, because it was biosynthetically determined by C-propeptides (16, 20). Even type III collagen, which consists of three identical chains disulfide linked at the C terminus of the triple-helix, exhibits hysteresis (21, 23). The difficulty in reaching equilibrium in reasonable time frames leads to an appearance of irreversibility that can be treated by kinetic analysis (27, 28), and Miles and Bailey have applied a kinetic approach to the collagen system (24–26).

Despite the impossibility of observing equilibrium unfolding of type I collagen, the isothermal data presented in Leikina et al. clearly show that human collagen is unstable at 36°C (16). In support of this conclusion, equilibrium unfolding curves have been reported recently for type III collagen retaining the N-propeptide, a molecule with three interchain disulfide bonds at both the N and C termini (22). Incubation of this doubly cross-linked collagen for 24 h at each temperature led to an equilibrium Tm value of 35°C, significantly below body temperature.

The existence of an unstable structural molecule that forms some of the most stable tissue structures in the body seems like a paradox. However, collagen molecules are not in equilibrium in vivo, and “unstable” native collagen molecules do successfully navigate the biosynthetic process, getting secreted and incorporated into durable fibrils. There is evidence that collagen in the cell is more stable than expected from in vitro studies (29), and this increased stability is likely to come from binding energy. Such binding includes the interaction of chaperone Hsp47 with triple-helical procollagen in the endoplasmic reticulum (Fig. 1), although its contribution to stability is controversial (30, 31). In the Golgi, lateral aggregation of procollagen molecules is observed (32–34), and longer aggregates are seen in secretory vesicles (35). Early forms of fibrils with an axial 67-nm periodicity are found in cell invaginations, followed by growth to mature fibrils (36). Mammalian collagen fibrils have a thermal stability near 60°C, much higher than body temperature, and stability is no longer an issue. During this entire complex process, there is little evidence of soluble procollagen or collagen molecules being present in an unbound form for any significant time in the intracellular or extracellular space. Analogous to the situation in fibrillar collagens, the presence of supramolecular structures in non-fibrillar collagens (1) and the collagenous domains of host-defense proteins (37) may promote stabilization. For example, the 78-residue repeating Gly-X-Y domain of C1q has a Tm = 46°C, well above body temperature, which is likely to come from the hexamer association of triple-helical molecules (38).

The presence of collagen in complexes and aggregates eliminates the biological need to have individual molecules stable for long times at body temperature, yet the observation of collagen Tm values below body temperature may have physiological relevance. Having a global stability just below body temperature makes it more likely that regions of lower stability undergo “microunfolding,” defined as reversible local structural perturbation (18, 39, 40). Such locally mobile regions would favor self-association and interactions in collagen molecules and fibrils. Local flexibility of the triple-helix has been implicated in recognition of the matrix metalloproteinase cleavage site in collagen (41), binding of a monoclonal antibody to type III collagen (42), heparin binding to the collagen tail of acetylcholinesterase (43), and the temperature-dependent ligand binding by the triple-helix domain of the macrophage scavenger receptor (44). Less stable sites could also play a role in degradation, either of newly synthesized collagen in proteosomes or of collagen fibrils by matrix metalloproteinases.

In addition to a physiological role of unstable local regions in binding and breakdown, inherent instability could lead to pathological consequences when there are mutations in the collagen triple-helix (16). Mutations in collagens have been implicated in a range of hereditary connective tissue diseases, including osteogenesis imperfecta (type I collagen), various chondrodysplasias (type II collagen), Ehlers-Danlos syndrome (type III collagen), dystrophic form of epidermolysis bullosa (type VII collagen), and Alport syndrome (type IV collagen; ref. 2–4). Missense mutations leading to a Gly substitution that breaks the (Gly-X-Y)n repeating pattern in the collagen triple-helix are common molecular defects, and such mutant collagens appear to have defective folding and a small decrease in thermal stability (8, 13, 45). Leikin points out that even a small decrease in stability could have a dramatic effect on the collagen unfolding rate at body temperature (16). Detailed investigations of the rate-dependent folding and unfolding of mutant collagens will clarify whether molecular instability is an important consideration in understanding the etiology of connective tissue diseases.

Byers, P. H. Royce, P. M. & Steinmann, B., eds. (1993) in Connective Tissue and Its Hereditable Disorders (Wiley–Liss, New York). .

Prockop, D. J. & Kivirikko, K. I. (1995). Annu. Rev. Biochem. 64, 403434 . [PubMed][Full Text]

Myllyharju, J. & Kivirikko, K. I. (2001). Ann. Med. 33, 721 . [PubMed]

Rich, A. & Crick, F. H. C. (1961). J. Mol. Biol. 3, 483506 . [PubMed]

Ramachandran, G. N. Ramachandran, G. N., ed. (1964) in Treatise on Collagen (Academic, New York). .

Bella, J., Eaton, M., Brodsky, B., & Berman, H. M. (1994). Science 266, 7581 . [PubMed]

Engel, J. & Prockop, D. J. (1991). Annu. Rev. Biophys. Biophys. Chem. 20, 137152 . [PubMed]

Nagase, H. & Woessner, J. F., Jr. (1999). J. Biol. Chem. 274, 2149121494 . [PubMed][Free Full Text]

Mathews, M. B. (1975) in Connective Tissue: Macromolecular Structure and Evolution (Springer, New York). .

Baker, A. T., Ramshaw, J. A. M., Chan, D., Cole, W. G., & Bateman, J. F. (1989). Biochem. J. 261, 253257 . [PubMed]

Bachinger, H. P., Morris, N. P., & Davis, J. M. (1993). Am. J. Med. Gen. 45, 152162 . [PubMed]

Raghunath, M., Bruckner, P., & Steinmann, B. (1994). J. Mol. Biol. 236, 940949 . [PubMed][Full Text]

Burjanadze, T. V. (2000). Biopolymers 53, 523528 . [PubMed][Full Text]

Persikov, A. V., Ramshaw, J. A., Kirkpatrick, A., & Brodsky, B. (2000). Biochemistry 39, 1496014967 . [PubMed][Full Text]

Leikina, E., Mertts, M. V., Kuznetsova, N., & Leikin, S. (2002). Proc. Natl. Acad. Sci. USA 99, 13141318 . [ Free Full text in PMC]

Privalov, P. L. (1979). Adv. Protein Chem. 33, 167241 . [PubMed]

Privalov, P. L. (1982). Adv. Prot. Chem. 35, 1104 . [PubMed]

von Hippel, P. H. Ramachandran, G. N., ed. (1967) in Treatise on Collagen (Academic, London). .

Traub, W. & Piez, K. A. (1971). Adv. Prot. Chem. 25, 243352 . [PubMed]

Engel, J. & Bachinger, H. P. (2000). Matrix Biol. 19, 235244 . [PubMed][Full Text]

Bachinger, H. P. & Engel, J. (2001). Matrix Biol. 20, 267269 .

Davis, J. M. & Bachinger, H. P. (1993). J. Biol. Chem. 268, 2596525972 . [PubMed][Free Full Text]

Miles, C. A. (1993). Int. J. Biol. Macromol. 15, 265271 . [PubMed]

Miles, C. A., Burjanadze, T. V., & Bailey, A. J. (1995). J. Mol. Biol. 245, 437446 . [PubMed][Full Text]

Miles, C. A. & Bailey, A. J. (2001). Matrix Biol. 20, 263265 . [PubMed][Full Text]

Potekhin, S. A. & Kovrigin, E. L. (1998). Biophys. Chem. 73, 241248 .

Sanchez-Ruiz, J. M. (1992). Biophys. J. 61, 921935 .

Bruckner, P. & Eikenberry, E. F. (1984). Eur. J. Biochem. 140, 397399 . [PubMed]

Tasab, M., Batten, M. R., & Bulleid, N. J. (2000). EMBO J. 19, 22042211 . [PubMed][Full Text]

Macdonald, J. R. & Bachinger, H. P. (2001). J. Biol. Chem. 276, 2539925403 . [PubMed][Free Full Text]

Trelstad, R. L. & Hayashi, K. (1979). Dev. Biol. 71, 228242 . [PubMed]

Hulmes, D. J., Bruns, R. R., & Gross, J. (1983). Proc. Natl. Acad. Sci. USA 80, 388392 . [ Free Full text in PMC]

Bonfanti, L., Mironov, A., Jr., Martinez-Menarguiez, J. A., Martella, O., Fusella, A., Baldassarre, M., Buccione, R., Geuze, H. J., Mironov, A. A., & Luini, A. (1998). Cell 95, 9931003 . [PubMed]

Trelstad, R. L. (1971). J. Cell Biol. 48, 689694 .

Birk, D. E. & Trelstad, R. L. (1984). J. Cell Biol. 99, 20242033 . [PubMed][Free Full Text]

Hoppe, H. J. & Reid, K. B. (1994). Protein Sci. 3, 11431158 . [PubMed]

Brodsky-Doyle, B., Leonard, K. R., & Reid, K. B. (1976). Biochem. J. 159, 279286 . [PubMed]

Ryhanen, L., Zaragoza, E. J., & Uitto, J. (1983). Arch. Biochem. Biophys. 223, 562571 . [PubMed]

Kadler, K. E., Hojima, Y., & Prockop, D. J. (1988). J. Biol. Chem. 263, 1051710523 . [PubMed][Free Full Text]

Fields, G. B. (1991). J. Theor. Biol. 153, 585602 . [PubMed]

Shah, N. K., Sharma, M., Kirkpatrick, A., Ramshaw, J. A., & Brodsky, B. (1997). Biochemistry 36, 58785883 . [PubMed][Full Text]

Deprez, P., Doss-Pepe, E., Brodsky, B., & Inestrosa, N. C. (2000). Biochem. J. 350, 283290 . [PubMed][Full Text]

Doi, T., Higashino, K., Kurihara, Y., Wada, Y., Miyazaki, T., Nakamura, H., Uesugi, S., Imanishi, T., Kawabe, Y., Itakura, H., et al. (1993). J. Biol. Chem. 268, 21262133 . [PubMed][Free Full Text]

Kuivaniemi, H., Tromp, G., & Prockop, D. J. (1991). FASEB J. 5, 20522060 . [PubMed]